pGL-p27UTR
(Plasmid
#20881)
-
Depositing Lab
-
Depositing OrganizationUniversity of California, San Francisco (UCSF)
Located in the United States of America -
Publication
-
Citations
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 20881 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 20881-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 20881-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepGL3-Control
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 5256
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namep27 3'UTR
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1300
-
GenBank IDNM_009875
-
Entrez GeneCdkn1b (a.k.a. Kip1, p27, p27Kip1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (destroyed during cloning)
- 3′ cloning site NheI (destroyed during cloning)
- 5′ sequencing primer GGAAAACTCGACGCAAGA
- 3′ sequencing primer CACATTTGTAGAGGTTTTACTTGCT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 20881-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 20881-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL-p27UTR was a gift from Robert Blelloch (Addgene plasmid # 20881 ; http://n2t.net/addgene:20881 ; RRID:Addgene_20881) -
For your References section:
Embryonic stem cell-specific microRNAs regulate the G1-S transition and promote rapid proliferation. Wang Y, Baskerville S, Shenoy A, Babiarz JE, Baehner L, Blelloch R. Nat Genet. 2008 Dec . 40(12):1478-83. 10.1038/ng.250 PubMed 18978791
Map uploaded by the depositor.