Skip to main content

pNHA_SBV_Gc
(Plasmid #208933)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 208933 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pCMV-HA
  • Backbone manufacturer
    Christopher A Walsh
  • Backbone size w/o insert (bp) 3800
  • Total vector size (bp) 6155
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Gc
  • Alt name
    G1, glycoprotein, envelope protein
  • Insert Size (bp)
    2358
  • Mutation
    Deleted 1682 bp from 5' end, deleted 378 bp from 3' end and inserted stop codon so Gc expressed
  • GenBank ID
    HE649913.1
  • Promoter CMV
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CAGGAAACAGCTATGAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    SBV genes were cloned from plasmids provided by Prof. Massimo Palmarini, University of Glasgow.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNHA_SBV_Gc was a gift from Gerald Barry (Addgene plasmid # 208933 ; http://n2t.net/addgene:208933 ; RRID:Addgene_208933)
Commonly requested with: