Skip to main content

pAAV-CMV-FLEX-SaCas9-U6-sgCnr1
(Plasmid #209196)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 209196 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pAAV-FLEX-SaCas9-U6-sgRNA
  • Backbone manufacturer
    Larry Zweifel (Addgene plasmid # 124844)
  • Vector type
    Mouse Targeting, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cnr1
  • gRNA/shRNA sequence
    AAGGCCTGCATCGGAGACTGC
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Cnr1 (a.k.a. CB-R, CB1, CB1A, CB1B, CB1R)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CMV-FLEX-SaCas9-U6-sgCnr1 was a gift from Larry Zweifel (Addgene plasmid # 209196 ; http://n2t.net/addgene:209196 ; RRID:Addgene_209196)
  • For your References section:

    A cortico-amygdala neural substrate for endocannabinoid modulation of fear extinction. Gunduz-Cinar O, Castillo LI, Xia M, Van Leer E, Brockway ET, Pollack GA, Yasmin F, Bukalo O, Limoges A, Oreizi-Esfahani S, Kondev V, Baldi R, Dong A, Harvey-White J, Cinar R, Kunos G, Li Y, Zweifel LS, Patel S, Holmes A. Neuron. 2023 Jul 19:S0896-6273(23)00482-8. doi: 10.1016/j.neuron.2023.06.023. 10.1016/j.neuron.2023.06.023 PubMed 37480845