psiCHECK2-let-7 2x
(Plasmid
#20929)
-
Depositing Lab
-
Depositing OrganizationThe University of Tokyo
Located in Japan -
Citations
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 20929 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 20929-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 20929-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepsiCHECK-2
- Backbone size w/o insert (bp) 6273
-
Vector typeMammalian Expression, Insect Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name2x let-7 target sites
-
Insert Size (bp)54
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TAAGTACATCAAGAGCTTCG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Single let7 site sequence is - 5'-TCGAGACTATACAAGGATCTACCTCAG
DNA (Catalog # 20929-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 20929-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
psiCHECK2-let-7 2x was a gift from Yukihide Tomari (Addgene plasmid # 20929 ; http://n2t.net/addgene:20929 ; RRID:Addgene_20929) -
For your References section:
Drosophila argonaute1 and argonaute2 employ distinct mechanisms for translational repression. Iwasaki S, Kawamata T, Tomari Y. Mol Cell. 2009 Apr 10;34(1):58-67. doi: 10.1016/j.molcel.2009.02.010. Epub 2009 Mar 5. 10.1016/j.molcel.2009.02.010 PubMed 19268617