Skip to main content

psiCHECK2-let-7 8x
(Plasmid #20931)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 20931 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 20931-D50 50 μg of DNA in Tris buffer $495
DNA 20931-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    psiCHECK-2
  • Backbone manufacturer
    promega
  • Backbone size w/o insert (bp) 6273
  • Vector type
    Mammalian Expression, Insect Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    8x let-7 target sites
  • Insert Size (bp)
    216

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TAAGTACATCAAGAGCTTCG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Single let7 site sequence is - 5'-TCGAGACTATACAAGGATCTACCTCAG

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    psiCHECK2-let-7 8x was a gift from Yukihide Tomari (Addgene plasmid # 20931 ; http://n2t.net/addgene:20931 ; RRID:Addgene_20931)
  • For your References section:

    Drosophila argonaute1 and argonaute2 employ distinct mechanisms for translational repression. Iwasaki S, Kawamata T, Tomari Y. Mol Cell. 2009 Apr 10;34(1):58-67. doi: 10.1016/j.molcel.2009.02.010. Epub 2009 Mar 5. 10.1016/j.molcel.2009.02.010 PubMed 19268617