pGL4.23_Ptgs2
(Plasmid
#209519)
-
PurposeExpresses luciferase under control of Ptgs2 promoter in transfected cells
-
Depositing Lab
-
Depositing OrganizationUniversity of Toronto
Located in Canada -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 209519 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 209519-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 209519-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepGL4.23
- Backbone size w/o insert (bp) 4283
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePtgs2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)801
-
Entrez GenePtgs2 (a.k.a. COX2, Cox-2, PES-2, PGHS-2, PHS II, PHS-2, Pghs2, TIS10, gripghs)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site NcoI (not destroyed)
- 5′ sequencing primer AGCATTCCGATGAAGTGGAGCT
- 3′ sequencing primer GGAGGTGGCAGTAGTGGTGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 209519-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 209519-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL4.23_Ptgs2 was a gift from Jennifer Mitchell (Addgene plasmid # 209519 ; http://n2t.net/addgene:209519 ; RRID:Addgene_209519) -
For your References section:
SOX4 exerts contrasting regulatory effects on labor-associated gene promoters in myometrial cells. Khader N, Shchuka VM, Dorogin A, Shynlova O, Mitchell JA. PLoS One. 2024 Apr 18;19(4):e0297847. doi: 10.1371/journal.pone.0297847. eCollection 2024. 10.1371/journal.pone.0297847 PubMed 38635533