Skip to main content

pGL4.23_Ptgs2
(Plasmid #209519)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 209519 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 209519-D50 50 μg of DNA in Tris buffer $495
DNA 209519-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pGL4.23
  • Backbone size w/o insert (bp) 4283
  • Vector type
    Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Ptgs2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    801
  • Entrez Gene
    Ptgs2 (a.k.a. COX2, Cox-2, PES-2, PGHS-2, PHS II, PHS-2, Pghs2, TIS10, gripghs)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site NcoI (not destroyed)
  • 5′ sequencing primer AGCATTCCGATGAAGTGGAGCT
  • 3′ sequencing primer GGAGGTGGCAGTAGTGGTGG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL4.23_Ptgs2 was a gift from Jennifer Mitchell (Addgene plasmid # 209519 ; http://n2t.net/addgene:209519 ; RRID:Addgene_209519)
  • For your References section:

    SOX4 exerts contrasting regulatory effects on labor-associated gene promoters in myometrial cells. Khader N, Shchuka VM, Dorogin A, Shynlova O, Mitchell JA. PLoS One. 2024 Apr 18;19(4):e0297847. doi: 10.1371/journal.pone.0297847. eCollection 2024. 10.1371/journal.pone.0297847 PubMed 38635533