lentiCRISPR v2-sgCYFIP1-2
(Plasmid
#210138)
-
Purposeknock out CYFIP1 in mammalian cells
-
Depositing Lab
-
Depositing OrganizationUniversity of Texas MD Anderson Cancer Center
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 210138 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 210138-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 210138-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonelentiCRISPR v2
-
Backbone manufacturerFeng Zhang
- Backbone size w/o insert (bp) 12000
- Total vector size (bp) 12000
-
Vector typeCRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCytoplasmic FMR1-interacting protein 1
-
Alt nameCYFIP1
-
gRNA/shRNA sequenceTAACGAGCAGCCTAACAGAG
-
SpeciesH. sapiens (human)
-
GenBank IDNM_014608.6
-
Entrez GeneCYFIP1 (a.k.a. P140SRA-1, SHYC, SRA-1, SRA1)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 210138-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 210138-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lentiCRISPR v2-sgCYFIP1-2 was a gift from Boyi Gan (Addgene plasmid # 210138 ; http://n2t.net/addgene:210138 ; RRID:Addgene_210138) -
For your References section:
Actin cytoskeleton vulnerability to disulfide stress mediates disulfidptosis. Liu X, Nie L, Zhang Y, Yan Y, Wang C, Colic M, Olszewski K, Horbath A, Chen X, Lei G, Mao C, Wu S, Zhuang L, Poyurovsky MV, James You M, Hart T, Billadeau DD, Chen J, Gan B. Nat Cell Biol. 2023 Mar;25(3):404-414. doi: 10.1038/s41556-023-01091-2. Epub 2023 Feb 6. 10.1038/s41556-023-01091-2 PubMed 36747082