Skip to main content
Addgene
Open Menu

lentiCRISPR v2-sgCYFIP1-2
(Plasmid #210138)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 210138 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 210138-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 210138-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    lentiCRISPR v2
  • Backbone manufacturer
    Feng Zhang
  • Backbone size w/o insert (bp) 12000
  • Total vector size (bp) 12000
  • Vector type
    CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cytoplasmic FMR1-interacting protein 1
  • Alt name
    CYFIP1
  • gRNA/shRNA sequence
    TAACGAGCAGCCTAACAGAG
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_014608.6
  • Entrez Gene
    CYFIP1 (a.k.a. P140SRA-1, SHYC, SRA-1, SRA1)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lentiCRISPR v2-sgCYFIP1-2 was a gift from Boyi Gan (Addgene plasmid # 210138 ; http://n2t.net/addgene:210138 ; RRID:Addgene_210138)

  • For your References section:

    Actin cytoskeleton vulnerability to disulfide stress mediates disulfidptosis. Liu X, Nie L, Zhang Y, Yan Y, Wang C, Colic M, Olszewski K, Horbath A, Chen X, Lei G, Mao C, Wu S, Zhuang L, Poyurovsky MV, James You M, Hart T, Billadeau DD, Chen J, Gan B. Nat Cell Biol. 2023 Mar;25(3):404-414. doi: 10.1038/s41556-023-01091-2. Epub 2023 Feb 6. 10.1038/s41556-023-01091-2 PubMed 36747082
Related items:
Commonly requested with: