Skip to main content

PRS_8-jRGECO1a
(Plasmid #210399)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 210399 Standard format: Plasmid sent in bacteria as agar stab 1 $94

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV2
  • Backbone size w/o insert (bp) 4087
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    jRGeco1a
  • Species
    Synthetic
  • Insert Size (bp)
    1413
  • Promoter PRSx8

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (destroyed during cloning)
  • 3′ cloning site HindIII (destroyed during cloning)
  • 5′ sequencing primer aacgcgtattagcttccgctag
  • 3′ sequencing primer aagcaatagcatgatacaaagg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2022.01.22.477348 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PRS_8-jRGECO1a was a gift from Simon Wiegert (Addgene plasmid # 210399 ; http://n2t.net/addgene:210399 ; RRID:Addgene_210399)
  • For your References section:

    A comparison of viral strategies and model systems to target norepinephrine neurons in the locus coeruleus reveals high variability in transgene expression patterns. Wissing C, Eschholz LS, Maheu M, Sauter K, Morellini F, Wiegert JS, Dieter A. PLoS Biol. 2025 Jul 7;23(7):e3003228. doi: 10.1371/journal.pbio.3003228. eCollection 2025 Jul. 10.1371/journal.pbio.3003228 PubMed 40623068