Skip to main content

PRS_8-GCaMP8m
(Plasmid and Viral Vector Prep for #210400)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 210400 Standard format: Plasmid sent in bacteria as agar stab 1 $89
AAV2 210400-AAV2 Virus (100 µL at titer ≥ 6×10¹² vg/mL) and Plasmid. $1032

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV2
  • Backbone size w/o insert (bp) 4093
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GCaMP8m
  • Species
    Synthetic
  • Insert Size (bp)
    1269
  • Promoter PRSx8

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer aacgcgtattagcttccgctag
  • 3′ sequencing primer aagcaatagcatgatacaaagg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2022.01.22.477348 for bioRxiv preprint.

Purpose

Ready-to-use AAV2 particles produced from PRS_8-GCaMP8m (#210400). In addition to the viral particles, you will also receive purified PRS_8-GCaMP8m plasmid DNA.

PRS-driven expression of calcium sensor GCaMP8m. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 6×10¹² vg/mL
  • Pricing $1000 USD for preparation of 100 µL virus + $32 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV2 cap gene
  • Buffer PBS + 0.001% Poloxamer 188 + 200 mM NaCl
  • Serotype AAV2
  • Purification Iodixanol gradient ultracentrifugation

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PRS_8-GCaMP8m was a gift from Simon Wiegert (Addgene plasmid # 210400 ; http://n2t.net/addgene:210400 ; RRID:Addgene_210400) For viral preps, please replace (Addgene plasmid # 210400) in the above sentence with: (Addgene viral prep # 210400-AAV2)
  • For your References section:

    A comparison of viral strategies and model systems to target norepinephrine neurons in the locus coeruleus reveals high variability in transgene expression patterns. Wissing C, Eschholz LS, Maheu M, Sauter K, Morellini F, Wiegert JS, Dieter A. PLoS Biol. 2025 Jul 7;23(7):e3003228. doi: 10.1371/journal.pbio.3003228. eCollection 2025 Jul. 10.1371/journal.pbio.3003228 PubMed 40623068