pOttc556 - pAAV EF1a iCre
(Plasmid #210416)

• Purpose: AAV viral vector packaging plasmid that expresses "improved Cre recombinase"
• Depositing Labs: Brandon Harvey, Christopher Richie
• Publication: Harvey/Richie Labs AAV Cre plasmids (unpublished)

Backbone

• Vector backbone: pOTTC293 - pAAV EF1a V5-tagged synuclein WT
• Backbone manufacturer: NIDA GEVVC (Addgene plasmid # 60057)
• Backbone size w/o insert (bp): 5341
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: iCre
• Species: H. sapiens (human)
• Insert Size (bp): 1056
• Promoter: EF1a

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: BamHI-Forward ATGGTGCCCAAGAAGAAGAGGA
• 3′ sequencing primer: WPRE R1 CATAGCGTAAAAGGAGCAACA

Resource Information

• Supplemental Documents:
  • pAAV EF1a iCre sequence file
• A portion of this plasmid was derived from a plasmid made by: NIDA GEVVC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry