Skip to main content

INS-3'gRNA
(Plasmid #210468)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 210468 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988)
  • Backbone manufacturer
    Feng Zhang laboratory
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    INS
  • gRNA/shRNA sequence
    (g)TGCAACTAGACGCAGCCCGC
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    21
  • Entrez Gene
    INS (a.k.a. IDDM, IDDM1, IDDM2, ILPR, IRDN, MODY10, PNDM4)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer LKO1.5: GACTATCATATGCTTACCGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    INS-3'gRNA was a gift from Kai Wang (Addgene plasmid # 210468 ; http://n2t.net/addgene:210468 ; RRID:Addgene_210468)
  • For your References section:

    Protocol for scarless genome editing of human pluripotent stem cell based on orthogonal selective reporters. Zhao Y, Pan Z, Hong Z, Sun M, Hong Y, Peng X, Li X, Wang X, Wang K. STAR Protoc. 2024 May 23;5(2):103084. doi: 10.1016/j.xpro.2024.103084. 10.1016/j.xpro.2024.103084 PubMed 38787727