pcDNA3.1_SM-FLuc0-malat1
(Plasmid
#210580)
-
PurposeExpresses SM(FLAG)-nonoptimal Firefly - 3'UTR malat1 triple helix
-
Depositing Lab
-
Depositing OrganizationUniversity of Colorado Denver and Anschutz Medical Campus
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 210580 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 210580-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 210580-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3.1
- Total vector size (bp) 8037
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSpaghetti monster (FLAG)-nonoptimal FLuc - 3'UTR malat1 triple helix
-
Alt nameFirefly
-
Alt nameFLuc
-
Insert Size (bp)2661
- Promoter CMV
-
Tag
/ Fusion Protein
- Spaghetti monster (FLAG) (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CMV_F
- 3′ sequencing primer cctaaagggagcccccgatttag
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 210580-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 210580-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1_SM-FLuc0-malat1 was a gift from Olivia Rissland (Addgene plasmid # 210580 ; http://n2t.net/addgene:210580 ; RRID:Addgene_210580) -
For your References section:
Synonymous codon usage regulates translation initiation. Barrington CL, Galindo G, Koch AL, Horton ER, Morrison EJ, Tisa S, Stasevich TJ, Rissland OS. Cell Rep. 2023 Dec 26;42(12):113413. doi: 10.1016/j.celrep.2023.113413. Epub 2023 Dec 12. 10.1016/j.celrep.2023.113413 PubMed 38096059