Skip to main content

pcDNA3.1_SM-FLuc0-malat1
(Plasmid #210580)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 210580 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 210580-D50 50 μg of DNA in Tris buffer $495
DNA 210580-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pcDNA3.1
  • Total vector size (bp) 8037
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Spaghetti monster (FLAG)-nonoptimal FLuc - 3'UTR malat1 triple helix
  • Alt name
    Firefly
  • Alt name
    FLuc
  • Insert Size (bp)
    2661
  • Promoter CMV
  • Tag / Fusion Protein
    • Spaghetti monster (FLAG) (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CMV_F
  • 3′ sequencing primer cctaaagggagcccccgatttag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1_SM-FLuc0-malat1 was a gift from Olivia Rissland (Addgene plasmid # 210580 ; http://n2t.net/addgene:210580 ; RRID:Addgene_210580)
  • For your References section:

    Synonymous codon usage regulates translation initiation. Barrington CL, Galindo G, Koch AL, Horton ER, Morrison EJ, Tisa S, Stasevich TJ, Rissland OS. Cell Rep. 2023 Dec 26;42(12):113413. doi: 10.1016/j.celrep.2023.113413. Epub 2023 Dec 12. 10.1016/j.celrep.2023.113413 PubMed 38096059