Skip to main content

pLV-tetO-mCherry-ACTU- -pre (neo)
(Plasmid #210719)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 210719 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pLenti CMVtight Neo DEST (w770-1)
  • Backbone manufacturer
    Eric Campeau (Addgene plasmid # 26432)
  • Backbone size w/o insert (bp) 9581
  • Total vector size (bp) 9045
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ACTU-
  • Species
    Synthetic
  • Insert Size (bp)
    72
  • Promoter CMV tight

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CACCgcccgggatccaccggtcg
  • 3′ sequencing primer taagatacattgatgagtttggacaa
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Banerjee, T., Biswas, D., Pal, D.S. et al. Spatiotemporal dynamics of membrane surface charge regulates cell polarity and migration. Nat Cell Biol 24, 1499–1515 (2022). https://doi.org/10.1038/s41556-022-00997-7

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

We adapted ACTU- from Banerjee, T., Biswas, D., Pal, D.S. et al.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV-tetO-mCherry-ACTU- -pre (neo) was a gift from Roland Friedel (Addgene plasmid # 210719 ; http://n2t.net/addgene:210719 ; RRID:Addgene_210719)