pLV-tetO-mCherry-ACTU- -pre (neo)
(Plasmid
#210719)
-
PurposeLentivirus for doxycycline-inducible expression of mCherry-ACTU- -pre
-
Depositing Lab
-
Depositing OrganizationIcahn School of Medicine at Mount Sinai
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 210719 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLenti CMVtight Neo DEST (w770-1)
-
Backbone manufacturerEric Campeau (Addgene plasmid # 26432)
- Backbone size w/o insert (bp) 9581
- Total vector size (bp) 9045
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameACTU-
-
SpeciesSynthetic
-
Insert Size (bp)72
- Promoter CMV tight
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CACCgcccgggatccaccggtcg
- 3′ sequencing primer taagatacattgatgagtttggacaa
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byBanerjee, T., Biswas, D., Pal, D.S. et al. Spatiotemporal dynamics of membrane surface charge regulates cell polarity and migration. Nat Cell Biol 24, 1499–1515 (2022). https://doi.org/10.1038/s41556-022-00997-7
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
We adapted ACTU- from Banerjee, T., Biswas, D., Pal, D.S. et al.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-tetO-mCherry-ACTU- -pre (neo) was a gift from Roland Friedel (Addgene plasmid # 210719 ; http://n2t.net/addgene:210719 ; RRID:Addgene_210719)