CHFR-PBZ-eGFP
(Plasmid
#211581)
-
PurposeExpressing CHFR PBZ domain fused to eGFP
-
Depositing Lab
-
Depositing OrganizationInstitute of Cancer Research
Located in the United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 211581 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 211581-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 211581-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerClontech
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCHFR PBZ domain
-
SpeciesH. sapiens (human)
-
MutationPBZ domain of the protein
-
Entrez GeneCHFR (a.k.a. RNF116, RNF196)
- Promoter CMV
-
Tag
/ Fusion Protein
- eGFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
N451S and V480M mutations in CHFR PBZ domain do not affect plasmid function.
DNA (Catalog # 211581-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 211581-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CHFR-PBZ-eGFP was a gift from Chris Lord (Addgene plasmid # 211581 ; http://n2t.net/addgene:211581 ; RRID:Addgene_211581) -
For your References section:
The ubiquitin-dependent ATPase p97 removes cytotoxic trapped PARP1 from chromatin. Krastev DB, Li S, Sun Y, Wicks AJ, Hoslett G, Weekes D, Badder LM, Knight EG, Marlow R, Pardo MC, Yu L, Talele TT, Bartek J, Choudhary JS, Pommier Y, Pettitt SJ, Tutt ANJ, Ramadan K, Lord CJ. Nat Cell Biol. 2022 Jan;24(1):62-73. doi: 10.1038/s41556-021-00807-6. Epub 2022 Jan 10. 10.1038/s41556-021-00807-6 PubMed 35013556