MTOR-F2108L_DARIC(1)_CD19-scFv_AAV6_Donor
(Plasmid
#211905)
-
PurposeVector for AAV6 donor production. Targeted CD19-scFv DARIC transgene integration to the MTOR locus with the dominant rapamycin resistance MTOR-F2108L mutation via homology-directed repair.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 211905 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepUC19
- Total vector size (bp) 10784
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDARIC-CD19-scFv
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1251
- Promoter hPGK1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GCGGCCTAAGCTTCCTGGAAG
- 3′ sequencing primer GCGCTCGAGGGTACCCCTAGGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Inverted terminal repeats (ITRs) integrity should be assessed via BssHII digestion after each transformation and plasmid purification.
Please visit https://doi.org/10.1101/2023.09.14.557485 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MTOR-F2108L_DARIC(1)_CD19-scFv_AAV6_Donor was a gift from Yannick Doyon (Addgene plasmid # 211905 ; http://n2t.net/addgene:211905 ; RRID:Addgene_211905) -
For your References section:
Pharmacological control of CAR T cells through CRISPR-driven rapamycin resistance. Levesque S, Carleton G, Duque V, Goupil C, Fiset J-P, Villeneuve S, Normandeau E, Morin G, Dumont N, Nelson BH, Laganière J, Boyle B, Lum JJ, Doyon Y. bioRxiv 2023.09.14.557485 10.1101/2023.09.14.557485