pcDNA5/FRT/TO GABARAP(G116A)-mTagBFP2
(Plasmid #212112)

• Purpose: Expression of C-terminally tagged GABARAP(G116A) with mTagBFP2
• Depositing Lab: Dieter Willbold
• Publication: Üffing et al Autophagy Reports, 3(1). doi: 10.1080/27694127.2024.2348899

Backbone

• Vector backbone: pcDNA5/FRT/TO
• Backbone manufacturer: Thermo Fisher
• Backbone size w/o insert (bp): 5049
• Total vector size (bp): 6160
• Modifications to backbone: Part of MCS removed (TTAAGCTTGGTACCGAGCTCGGATCCACTAGTCCAGTGTGGTGGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGTCTAGA), --> PmeI site followed by PspOMI site (TTTAAACGGGCCC), second PmeI site removed (gt --> ac) downstream of ApaI site
• Vector type: Mammalian Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GABARAP(G116A)-mTagBFP2
• Species: H. sapiens (human); Entacmaea quadricolor
• Insert Size (bp): 1111
• Mutation: G116A (lipidation deficiency) of GABARAP
• Entrez Gene: GABARAP (a.k.a. ATG8A, GABARAP-a, MM46)
• Promoter: CMV
• Tag / Fusion Protein:
  • mTagBFP2 (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: PmeI (not destroyed)
• 3′ cloning site: ApaI (not destroyed)
• 5′ sequencing primer: CMV-fw
• 3′ sequencing primer: BGH-rev

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry