Skip to main content
Addgene
Open Menu

pcDNA5/FRT/TO GABARAP(G116A)-mTagBFP2
(Plasmid #212112)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 212112 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 212112-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 212112-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pcDNA5/FRT/TO
  • Backbone manufacturer
    Thermo Fisher
  • Backbone size w/o insert (bp) 5049
  • Total vector size (bp) 6160
  • Modifications to backbone
    Part of MCS removed (TTAAGCTTGGTACCGAGCTCGGATCCACTAGTCCAGTGTGGTGGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGTCTAGA), --> PmeI site followed by PspOMI site (TTTAAACGGGCCC), second PmeI site removed (gt --> ac) downstream of ApaI site
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GABARAP(G116A)-mTagBFP2
  • Species
    H. sapiens (human); Entacmaea quadricolor
  • Insert Size (bp)
    1111
  • Mutation
    G116A (lipidation deficiency) of GABARAP
  • Entrez Gene
    GABARAP (a.k.a. ATG8A, GABARAP-a, MM46)
  • Promoter CMV
  • Tag / Fusion Protein
    • mTagBFP2 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PmeI (not destroyed)
  • 3′ cloning site ApaI (not destroyed)
  • 5′ sequencing primer CMV-fw
  • 3′ sequencing primer BGH-rev
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA5/FRT/TO GABARAP(G116A)-mTagBFP2 was a gift from Dieter Willbold (Addgene plasmid # 212112 ; http://n2t.net/addgene:212112 ; RRID:Addgene_212112)

  • For your References section:

    Highlighting the hidden: monitoring the avidity-driven association of a fluorescent GABARAP tandem with microtubules in living cells. Uffing A, Gold L, Gensch T, Weiergraber OH, Hoffmann S, Willbold D. Autophagy Rep. 2024 May 16;3(1):2348899. doi: 10.1080/27694127.2024.2348899. eCollection 2024. 10.1080/27694127.2024.2348899 PubMed 40395516
Related items: