CUP1-∆ssCPY*-mGFP
(Plasmid
#212197)
-
PurposeFluorescent reporter for cytoplasmic aggregates
-
Depositing Labs
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 212197 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepRS316
- Backbone size w/o insert (bp) 4887
- Total vector size (bp) 7776
-
Modifications to backbonepCUP1-∆ssCPY*-mGFP
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCarboxypeptidase Y variant
-
Alt name∆ssCPY*
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)1536
-
MutationDeletion signal peptide, G255A mutation
-
Entrez GenePRC1 (a.k.a. YMR297W, CPY1, LBC1)
- Promoter CUP1
-
Tag
/ Fusion Protein
- mEGFP (monomeric version EGFP, A206K mutation)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tgtatcaattgcattataatatcttcttgt
- 3′ sequencing primer aactaattacatgatatcgacaaaggaaaa
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CUP1-∆ssCPY*-mGFP was a gift from Mark Leake & Chris MacDonald (Addgene plasmid # 212197 ; http://n2t.net/addgene:212197 ; RRID:Addgene_212197)