Skip to main content

pOTTC1993 - pAAV EF1a CoV2 protE-2xStrep
(Plasmid #213543)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 213543 Standard format: Plasmid sent in bacteria as agar stab 1 $94

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pOTTC1464 - pAAV EF1a NheI iRFP-FLAG AscI
  • Backbone manufacturer
    NIDA GEVVC
  • Backbone size w/o insert (bp) 5396
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CoV2 protE-2xStrep
  • Species
    H. sapiens (human); Severe acute respiratory syndrome coronavirus 2
  • Insert Size (bp)
    330
  • Entrez Gene
    E (a.k.a. GU280_gp04)
  • Promoter EF1a

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer EF-1a-Forward TCAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer WPRE R1 CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    NIDA GEVVC
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOTTC1993 - pAAV EF1a CoV2 protE-2xStrep was a gift from Brandon Harvey & Christopher Richie (Addgene plasmid # 213543 ; http://n2t.net/addgene:213543 ; RRID:Addgene_213543)