pT7-AGG-SpCas9
(Plasmid
#214603)
-
Purposeencode SpCas9; in vitro transcribed modified RNA vector
-
Depositing Lab
-
Depositing OrganizationPeking University Health Science Center
Located in China -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 214603 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 214603-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 214603-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepUC57
-
Vector typeCRISPR, Unspecified
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSpCas9
- Promoter T7
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gacaagaagtacagcatcgg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 214603-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 214603-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT7-AGG-SpCas9 was a gift from Yuxuan Guo (Addgene plasmid # 214603 ; http://n2t.net/addgene:214603 ; RRID:Addgene_214603) -
For your References section:
Modified mRNA-based gene editing reveals sarcomere-based regulation of gene expression in human induced-pluripotent stem cell-derived cardiomyocytes. Huang Y, Zhang Y, Wang Z, Miao L, Tan P, Guan Y, Ran Y, Feng X, Wang Y, Guo Y, Guo X. Int Immunopharmacol. 2024 Oct 17;143(Pt 2):113378. doi: 10.1016/j.intimp.2024.113378. 10.1016/j.intimp.2024.113378 PubMed 39423657