pcDNA3_pLyn_EGFP
(Plasmid
#214605)
-
PurposeExpresses fluorescent protein EGFP targeted to plasma membrane
-
Depositing Lab
-
Depositing OrganizationKatholieke Universiteit Leuven
Located in Belgium -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 214605 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepcDNA3
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namelyn-EGFP
-
Insert Size (bp)759
- Promoter CMV
-
Tag
/ Fusion Protein
- lyn targetting (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GCAAATGGGCGGTAGGCGT
- 3′ sequencing primer TAGAAGGCACAGTCGAGGCT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3_pLyn_EGFP was a gift from Peter Dedecker (Addgene plasmid # 214605 ; http://n2t.net/addgene:214605 ; RRID:Addgene_214605) -
For your References section:
Per-pixel unmixing of spectrally overlapping fluorophores using intra-exposure excitation modulation. Valenta H, Bierbuesse F, Vitale R, Ruckebusch C, Vandenberg W, Dedecker P. Talanta. 2024 Mar 10.1016/j.talanta.2023.125397 PubMed 38048682