-
Depositing Lab
-
Depositing OrganizationUniversity of Southern California
Located in the United States of America -
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 21484 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 21484-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 21484-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneJP027/CAG
- Backbone size w/o insert (bp) 5868
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameChannel Rhodopsin 2 EGFP Myosin Binding Domain
-
Alt nameCHR2-MBD
-
Alt nameChannel Rhodopsin 2
-
Alt nameMelanophilin
-
SpeciesMixture
-
Insert Size (bp)1801
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Nhe1 (not destroyed)
- 3′ cloning site Nsi1 (not destroyed)
- 5′ sequencing primer gcaacgtgctggttgttgtgc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
ChR2-MBD was constructed by inserting the sequence encoding Melanophilin amino acids 176–201 downstream of the Venus gene in the CAG-ChR2-Venus vector.
DNA (Catalog # 21484-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 21484-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CHR2-MBD was a gift from Don Arnold (Addgene plasmid # 21484 ; http://n2t.net/addgene:21484 ; RRID:Addgene_21484) -
For your References section:
Myosin-dependent targeting of transmembrane proteins to neuronal dendrites. Lewis TL, Mao T, Svoboda K, Arnold DB. Nat Neurosci. 2009 May . 12(5):568-76. 10.1038/nn.2318 PubMed 19377470