Skip to main content

CHR2-MBD
(Plasmid #21484)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 21484 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 21484-D50 50 μg of DNA in Tris buffer $495
DNA 21484-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    JP027/CAG
  • Backbone size w/o insert (bp) 5868
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Channel Rhodopsin 2 EGFP Myosin Binding Domain
  • Alt name
    CHR2-MBD
  • Alt name
    Channel Rhodopsin 2
  • Alt name
    Melanophilin
  • Species
    Mixture
  • Insert Size (bp)
    1801

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nhe1 (not destroyed)
  • 3′ cloning site Nsi1 (not destroyed)
  • 5′ sequencing primer gcaacgtgctggttgttgtgc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

ChR2-MBD was constructed by inserting the sequence encoding Melanophilin amino acids 176–201 downstream of the Venus gene in the CAG-ChR2-Venus vector.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CHR2-MBD was a gift from Don Arnold (Addgene plasmid # 21484 ; http://n2t.net/addgene:21484 ; RRID:Addgene_21484)
  • For your References section:

    Myosin-dependent targeting of transmembrane proteins to neuronal dendrites. Lewis TL, Mao T, Svoboda K, Arnold DB. Nat Neurosci. 2009 May . 12(5):568-76. 10.1038/nn.2318 PubMed 19377470