CHR2-MBD
(Plasmid #21484)

• Depositing Lab: Don Arnold
• Publication: Lewis et al Nat Neurosci. 2009 May . 12(5):568-76.

Backbone

• Vector backbone: JP027/CAG
• Backbone size w/o insert (bp): 5868
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Channel Rhodopsin 2 EGFP Myosin Binding Domain
• Alt name: CHR2-MBD
• Alt name: Channel Rhodopsin 2
• Alt name: Melanophilin
• Species: Mixture
• Insert Size (bp): 1801

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Nhe1 (not destroyed)
• 3′ cloning site: Nsi1 (not destroyed)
• 5′ sequencing primer: gcaacgtgctggttgttgtgc

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

ChR2-MBD was constructed by inserting the sequence encoding Melanophilin amino acids 176–201 downstream of the Venus gene in the CAG-ChR2-Venus vector.