Skip to main content

pPB.DEST-ITGB1(WT)-mRuby2
(Plasmid #215448)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 215448 Standard format: Plasmid sent in bacteria as agar stab 1 $94 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pPB.DEST
  • Total vector size (bp) 8986
  • Vector type
    Mammalian Expression ; Transposon-based stable expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ITGB1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3120
  • Mutation
    Silent mutations added to disrupt shRNA binding aagainst endogenous ITGB1 between 2940-2960 bp (target seq: GCCTTGCATTACTGCTGATAT)
  • GenBank ID
    NM_002211.4
  • Entrez Gene
    ITGB1 (a.k.a. CD29, FNRB, GPIIA, MDF2, MSK12, VLA-BETA, VLAB)
  • Promoter CAG
  • Tag / Fusion Protein
    • mRuby2 (C terminal on insert)

Cloning Information

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPB.DEST-ITGB1(WT)-mRuby2 was a gift from Johanna Ivaska (Addgene plasmid # 215448 ; http://n2t.net/addgene:215448 ; RRID:Addgene_215448)
  • For your References section:

    Dynamic regulation of integrin beta1 phosphorylation supports invasion of breast cancer cells. Conway JRW, Joshi O, Kaivola J, Follain G, Gounis M, Kuhl D, Ivaska J. Nat Cell Biol. 2025 May 26. doi: 10.1038/s41556-025-01663-4. 10.1038/s41556-025-01663-4 PubMed 40419795