CaMKII ER-Halo-GCaMP6-150
(Plasmid
#216316)
-
PurposeFluorescent reporter for ratiometric imaging of ER Ca2+ in excitatory neurons
-
Depositing Lab
-
Depositing OrganizationCornell University
Located in the United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 216316 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneFCK(1.3)GW
- Backbone size w/o insert (bp) 9246
- Total vector size (bp) 11601
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameER-Halo-GCaMP6-150
-
SpeciesSynthetic
-
Insert Size (bp)2355
- Promoter CamKII
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer acagtgccctgctcagaagc
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAddgene 86918 (ER-GCaMP6-150)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.02.15.580492 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CaMKII ER-Halo-GCaMP6-150 was a gift from Timothy Ryan (Addgene plasmid # 216316 ; http://n2t.net/addgene:216316 ; RRID:Addgene_216316) -
For your References section:
A ratiometric ER calcium sensor for quantitative comparisons across cell types and subcellular regions. Farrell RJ, Bredvik KG, Hoppa MB, Hennigan ST, Brown TA, Ryan TA. bioRxiv 2024.02.15.580492 10.1101/2024.02.15.580492