pFP122
(Plasmid
#21669)
-
Depositing Lab
-
Depositing OrganizationBrandeis University
Located in the United States of America -
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 21669 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneTed
-
Backbone manufacturerW. Kramer
-
Vector typecentromeric plasmid
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameLacz
-
Alt name2 copies of lacZ
-
Alt namepJH1439
-
Alt namesee author's map
-
SpeciesE. coli
-
Insert Size (bp)3000
-
MutationThe second lacZ sequence has been modified, the EcoRV/BclI fragment has been replaced by a 36-bp sequence (AG TTTCAGCTTTCCGCAATAGTATAATTTTATAAAC) which differs from an HO cut site by only one substitution but cannot be cut
-
Entrez GenelacZ (a.k.a. ECIAI39_0334)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bam Hi (not destroyed)
- 3′ cloning site Eco RI (not destroyed)
- 5′ sequencing primer n/a
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Derived from Ted, a centromeric plasmid (provided by W. Kramer) marked by the URA3 gene. Contains two copies of the Escherichia coli lacZ
gene in inverted orientation, with one copy containing an HO endonuclease
cleavage site.
Please note: Addgene was not able to sequence verify the critical features of this plasmid due to its repetitive nature.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFP122 was a gift from James Haber (Addgene plasmid # 21669 ; http://n2t.net/addgene:21669 ; RRID:Addgene_21669) -
For your References section:
Two pathways for removal of nonhomologous DNA ends during double-strand break repair in Saccharomyces cerevisiae. Pâques F, Haber JE. Mol Cell Biol. 1997 Nov . 17(11):6765-71. PubMed 9343441
Map uploaded by the depositor.