pCAX-SCLM
(Plasmid
#216757)
-
PurposeFor strong and long-lasting expression of SuperClomeleon in mammalian cells from the hybrid CAG promoter
-
Depositing Lab
-
Depositing OrganizationNanyang Technological University
Located in Singapore -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 216757 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 216757-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 216757-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCAX
- Backbone size w/o insert (bp) 4287
- Total vector size (bp) 5682
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSuperClomeleon
-
Alt nameCerulean/S30R/dC11-LE-Topaz/dN5/S30R/Q69T/V163A
-
SpeciesA. victoria (crystal jelly)
-
Insert Size (bp)1395
-
MutationS30R and 11 AA deletion in the Cerulean CFP moiety and 5 AA deletion, S30R, Q69T, and V163A in the Topaz YFP moiety
- Promoter CAG (cytomegalovirus-chicken beta-actin-rabbit beta-globin)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site BsrGI (not destroyed)
- 5′ sequencing primer tgctggttattgtgctgtctcatc
- 3′ sequencing primer ATATGTTGCCAAACTCTAAACC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 216757-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 216757-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAX-SCLM was a gift from George Augustine (Addgene plasmid # 216757 ; http://n2t.net/addgene:216757 ; RRID:Addgene_216757)
Map uploaded by the depositor.
