pCAX-SCLM
(Plasmid #216757)

• Purpose: For strong and long-lasting expression of SuperClomeleon in mammalian cells from the hybrid CAG promoter
• Depositing Lab: George Augustine
• Publication: AAV2 transfer vectors for a genetically encoded chloride indicator, SuperClomeleon (unpublished)

Backbone

• Vector backbone: pCAX
• Backbone size w/o insert (bp): 4287
• Total vector size (bp): 5682
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SuperClomeleon
• Alt name: Cerulean/S30R/dC11-LE-Topaz/dN5/S30R/Q69T/V163A
• Species: A. victoria (crystal jelly)
• Insert Size (bp): 1395
• Mutation: S30R and 11 AA deletion in the Cerulean CFP moiety and 5 AA deletion, S30R, Q69T, and V163A in the Topaz YFP moiety
• Promoter: CAG (cytomegalovirus-chicken beta-actin-rabbit beta-globin)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: BsrGI (not destroyed)
• 5′ sequencing primer: tgctggttattgtgctgtctcatc
• 3′ sequencing primer: ATATGTTGCCAAACTCTAAACC

Resource Information

• Supplemental Documents:
  • pCAX-SCLM.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry