pcDNA3.1-Zeo-otmyd88
(Plasmid
#217485)
-
PurposeExpression of Blue Fluorescent Protein - P2A - full length protein kinase R from chinook salmon
-
Depositing Lab
-
Depositing OrganizationINRAE Jouy-en-Josas
Located in France -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 217485 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepcDNA3.1-(-)-Zeo
-
Vector typeMammalian Expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBFP-P2A-otPKRFL
-
SpeciesOncorhynchus tshawytscha
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GGCTAACTAGAGAACCCACTG
- 3′ sequencing primer GGCAACTAGAAGGCACAGTC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-Zeo-otmyd88 was a gift from Bertrand Collet (Addgene plasmid # 217485 ; http://n2t.net/addgene:217485 ; RRID:Addgene_217485) -
For your References section:
Disruption of Myd88 in a salmonid epithelioid cell line reveals its contribution to bacterial detection and immune response. Rebl A, Peruzzi M, Collins C, Vendramin N, Boudinot P, Lorenzen N, Collet B. Cell Tissue Res. 2025 Oct 23. doi: 10.1007/s00441-025-04015-8. 10.1007/s00441-025-04015-8 PubMed 41125964