Skip to main content

pKSR1-CA3-EGFP (C-KSR)
(Plasmid #217753)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 217753 Standard format: Plasmid sent in bacteria as agar stab 1 $94 *
DNA 217753-D50 50 μg of DNA in Tris buffer $495 *
DNA 217753-D100 100 μg of DNA in Tris buffer $585 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone manufacturer
    Clonetech
  • Backbone size w/o insert (bp) 4600
  • Total vector size (bp) 4978
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Kinase suppressor of ras 1 CA3 domain
  • Alt name
    KSR1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    321
  • Mutation
    CA3 domain aa 317-400 plus vector-based linker LELKLRILQS (contains autophagy sequence)
  • GenBank ID
    XM_047436985
  • Entrez Gene
    KSR1 (a.k.a. KSR, RSU2)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CATTTTATGTTTCAGGTTCAGG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKSR1-CA3-EGFP (C-KSR) was a gift from Paula Nunes-Hasler (Addgene plasmid # 217753 ; http://n2t.net/addgene:217753 ; RRID:Addgene_217753)
  • For your References section:

    Development of Genetically Encoded Fluorescent KSR1-Based Probes to Track Ceramides during Phagocytosis. Girik V, van Ek L, Dentand Quadri I, Azam M, Cruz Cobo M, Mandavit M, Riezman I, Riezman H, Gavin AC, Nunes-Hasler P. Int J Mol Sci. 2024 Mar 5;25(5):2996. doi: 10.3390/ijms25052996. 10.3390/ijms25052996 PubMed 38474242