pKSR1-CA3-GS-mRFP1 (C-KSR-GS)
(Plasmid
#217758)
-
PurposeFluorescent reporter for ceramide (mammalian expression)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 217758 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepmRFP-N1
-
Backbone manufacturerClonetech
- Backbone size w/o insert (bp) 4600
- Total vector size (bp) 4691
-
Modifications to backboneSite directed mutagenesis of pKSR1-CA3-mRFP
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameKinase suppressor of ras 1 CA3 domain
-
Alt nameKSR1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)321
-
MutationCA3 domain aa 317-400 with GGSSGGGGA linker
-
GenBank IDXM_047436985
-
Entrez GeneKSR1 (a.k.a. KSR, RSU2)
- Promoter CMV
-
Tag
/ Fusion Protein
- mRFP (C terminal on backbone)
Cloning Information
- Cloning method Other
- 5′ sequencing primer CAACGGGACTTTCCAAAATG
- 3′ sequencing primer GGTTCAGGGGGAGGTGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKSR1-CA3-GS-mRFP1 (C-KSR-GS) was a gift from Paula Nunes-Hasler (Addgene plasmid # 217758 ; http://n2t.net/addgene:217758 ; RRID:Addgene_217758) -
For your References section:
Development of Genetically Encoded Fluorescent KSR1-Based Probes to Track Ceramides during Phagocytosis. Girik V, van Ek L, Dentand Quadri I, Azam M, Cruz Cobo M, Mandavit M, Riezman I, Riezman H, Gavin AC, Nunes-Hasler P. Int J Mol Sci. 2024 Mar 5;25(5):2996. doi: 10.3390/ijms25052996. 10.3390/ijms25052996 PubMed 38474242