pYJA5
(Plasmid
#217778)
-
Purpose(Empty Backbone) The empty vector for quadruple sgRNA cloning
-
Depositing Lab
-
Depositing OrganizationUniversity of Zurich
Located in Switzerland -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 217778 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonelenti-PB
- Backbone size (bp) 5500
-
Modifications to backboneFirst, the DNA fragment flanked by the recognition sites for the restriction enzymes MluI and AgeI in the lenti-PB vector was replaced by a synthesized DNA fragment that included the human U6 promoter and the fourth variant of tracrRNA, as well as an ampicillin resistance gene (β-lactamase expression cassette). Two BbsI (type II restriction enzyme) recognition sites flanking the β-lactamase expression cassette were introduced into the new fragment to facilitate the removal of the β-lactamase expression cassette. In a second step, the original ampicillin resistance (β-lactamase) expression cassette in the lenti-PB vector was removed between the two BspHI restriction enzyme recognition sites. Furthermore, all BsmBI recognition sites were mutated.
-
Vector typeMammalian Expression, Lentiviral, CRISPR, Synthetic Biology
- Promoter PGK, CMV, U6
-
Selectable markersPuromycin ; TagBFP
-
Tags
/ Fusion Proteins
- Puromycin resistance gene
- TagBFP (C terminal on insert)
- T2A (C terminal on insert)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGGAGCCGGTTGGCGCCTAC
- 3′ sequencing primer AGTACCGGGCCCTACGCGTT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYJA5 was a gift from Adriano Aguzzi (Addgene plasmid # 217778 ; http://n2t.net/addgene:217778 ; RRID:Addgene_217778) -
For your References section:
Arrayed CRISPR libraries for the genome-wide activation, deletion and silencing of human protein-coding genes. Yin JA, Frick L, Scheidmann MC, Liu T, Trevisan C, Dhingra A, Spinelli A, Wu Y, Yao L, Vena DL, Knapp B, Guo J, De Cecco E, Ging K, Armani A, Oakeley EJ, Nigsch F, Jenzer J, Haegele J, Pikusa M, Tager J, Rodriguez-Nieto S, Bouris V, Ribeiro R, Baroni F, Bedi MS, Berry S, Losa M, Hornemann S, Kampmann M, Pelkmans L, Hoepfner D, Heutink P, Aguzzi A. Nat Biomed Eng. 2024 Dec 4. doi: 10.1038/s41551-024-01278-4. 10.1038/s41551-024-01278-4 PubMed 39633028