pcDNA5_NLS-Halo-eGFP-BioID
(Plasmid
#218448)
-
Purposeexpresses the NLS-Halo-eGFP-BioID fusion protein via stable Flp-In integration
-
Depositing Lab
-
Depositing OrganizationEberhard Karls Universitaet Tuebingen
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 218448 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 218448-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 218448-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA5
- Backbone size w/o insert (bp) 5084
- Total vector size (bp) 7709
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNLS-Halo-eGFP-BirA
-
SpeciesE. coli, Rhodococcus rhodochrous, Aequorea victoria
-
Insert Size (bp)2625
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site ApaI (not destroyed)
- 5′ sequencing primer TTAAGCTTGGTACCGAGCTCGGATCC
- 3′ sequencing primer GATGGCTGGCAACTAGAAGGCACAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 218448-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 218448-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA5_NLS-Halo-eGFP-BioID was a gift from Thorsten Stafforst (Addgene plasmid # 218448 ; http://n2t.net/addgene:218448 ; RRID:Addgene_218448) -
For your References section:
Profiling the interactome of oligonucleotide drugs by proximity biotinylation. Hanswillemenke A, Hofacker DT, Sorgenfrei M, Fruhner C, Franz-Wachtel M, Schwarzer D, Macek B, Stafforst T. Nat Chem Biol. 2024 Jan 17. doi: 10.1038/s41589-023-01530-z. 10.1038/s41589-023-01530-z PubMed 38233583