Skip to main content

pCAG-EGFP-C-IFT52
(Plasmid #218725)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 218725 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 218725-D50 50 μg of DNA in Tris buffer $495
DNA 218725-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCAG-EGFP-C
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 6767
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    IFT52
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1803
  • Entrez Gene
    IFT52 (a.k.a. NGD2, NGD5, CGI-53, C20orf9, dJ1028D15.1)
  • Promoter CAG
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CTGAGCAAAGACCCCAACGAG
  • 3′ sequencing primer GCCAGAAGTCAGATGCTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-EGFP-C-IFT52 was a gift from Kazuhisa Nakayama (Addgene plasmid # 218725 ; http://n2t.net/addgene:218725 ; RRID:Addgene_218725)
  • For your References section:

    Robust interaction of IFT70 with IFT52-IFT88 in the IFT-B complex is required for ciliogenesis. Takei R, Katoh Y, Nakayama K. Biol Open. 2018 Apr 30;7(5). pii: bio.033241. doi: 10.1242/bio.033241. 10.1242/bio.033241 PubMed 29654116