pCAG-EGFP-C-IFT52
(Plasmid
#218725)
-
PurposeExpresses N-terminally EGFP-tagged IFT52 in mammalian cells
-
Depositing Lab
-
Depositing OrganizationKyoto University, Graduate School of Pharmaceutical Sciences
Located in Japan -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 218725 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 218725-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 218725-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCAG-EGFP-C
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 6767
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIFT52
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1803
-
Entrez GeneIFT52 (a.k.a. NGD2, NGD5, CGI-53, C20orf9, dJ1028D15.1)
- Promoter CAG
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CTGAGCAAAGACCCCAACGAG
- 3′ sequencing primer GCCAGAAGTCAGATGCTC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 218725-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 218725-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-EGFP-C-IFT52 was a gift from Kazuhisa Nakayama (Addgene plasmid # 218725 ; http://n2t.net/addgene:218725 ; RRID:Addgene_218725) -
For your References section:
Robust interaction of IFT70 with IFT52-IFT88 in the IFT-B complex is required for ciliogenesis. Takei R, Katoh Y, Nakayama K. Biol Open. 2018 Apr 30;7(5). pii: bio.033241. doi: 10.1242/bio.033241. 10.1242/bio.033241 PubMed 29654116