pCAG2-EGFP-C-IFT122
(Plasmid
#218737)
-
PurposeExpresses C-terminally EGFP-tagged IFT122 in mammalian cells
-
Depositing Lab
-
Depositing OrganizationKyoto University, Graduate School of Pharmaceutical Sciences
Located in Japan -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 218737 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCAG2-EGFP-C
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 5946
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIFT122
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3546
-
Entrez GeneIFT122 (a.k.a. CED, CED1, CFAP80, FAP80, SPG, WDR10, WDR10p, WDR140)
- Promoter CAG
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CTGAGCAAAGACCCCAACGAG
- 3′ sequencing primer GCCAGAAGTCAGATGCTC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid expresses transcript variant 3, which lacks two alternate in-frame exons in the 5' coding region, compared to variant 1. It encodes isoform 3. RefSeq : NM_018262.4
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG2-EGFP-C-IFT122 was a gift from Kazuhisa Nakayama (Addgene plasmid # 218737 ; http://n2t.net/addgene:218737 ; RRID:Addgene_218737)