pTE1643
(Plasmid
#219650)
-
PurposeGeneration of nonsense mutation W241* in DesD, disrupting desferrioxamine biosynthesis by base editing CRISPR
-
Depositing Lab
-
Depositing OrganizationUniversity of Manchester
Located in the United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 219650 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCRISPR-cBEST
-
Backbone manufacturerAddgene plasmid #125689 (Weber lab)
- Backbone size w/o insert (bp) 12247
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Apramycin, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA targetting desD in Streptomyces
-
gRNA/shRNA sequenceTGTTCCACCACTGCCAGGGG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCGTCGATTTTTGTGATGCT
- 3′ sequencing primer TACGTAAAAAAAGCACCGAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTE1643 was a gift from Eriko Takano (Addgene plasmid # 219650 ; http://n2t.net/addgene:219650 ; RRID:Addgene_219650) -
For your References section:
Multi-omics analysis of interspecies interactions in a soil Streptomyces community provides functional insights into siderophore ecology. Connolly JA, Del Carratore F, Schmidt K, Bisesi AT, Martinson JNV, Chua J, Kuhs M, Boneza MM, Heinsch SC, Kinkel LL, Smanski MJ, Harcombe WR, Breitling R, Takano E. Sci Rep. 2026 Apr 6;16(1):11742. doi: 10.1038/s41598-026-45368-6. 10.1038/s41598-026-45368-6 PubMed 41942569