Skip to main content

pTE1643
(Plasmid #219650)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 219650 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pCRISPR-cBEST
  • Backbone manufacturer
    Addgene plasmid #125689 (Weber lab)
  • Backbone size w/o insert (bp) 12247
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Apramycin, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA targetting desD in Streptomyces
  • gRNA/shRNA sequence
    TGTTCCACCACTGCCAGGGG

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCGTCGATTTTTGTGATGCT
  • 3′ sequencing primer TACGTAAAAAAAGCACCGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTE1643 was a gift from Eriko Takano (Addgene plasmid # 219650 ; http://n2t.net/addgene:219650 ; RRID:Addgene_219650)
  • For your References section:

    Multi-omics analysis of interspecies interactions in a soil Streptomyces community provides functional insights into siderophore ecology. Connolly JA, Del Carratore F, Schmidt K, Bisesi AT, Martinson JNV, Chua J, Kuhs M, Boneza MM, Heinsch SC, Kinkel LL, Smanski MJ, Harcombe WR, Breitling R, Takano E. Sci Rep. 2026 Apr 6;16(1):11742. doi: 10.1038/s41598-026-45368-6. 10.1038/s41598-026-45368-6 PubMed 41942569