Skip to main content
Addgene
Open Menu

pNK5664
(Plasmid #219747)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 219747 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 219747-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 219747-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    Level 1-like
  • Backbone size w/o insert (bp) 2231
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pCMV - nnLuz_v4 - tSV40
  • Species
    Neonothopanus nambi
  • Insert Size (bp)
    1732

Cloning Information

  • Cloning method Golden Gate
  • 5′ sequencing primer cctataaaaataggcgtatcacgaggcag
  • 3′ sequencing primer agtcagtgagcgaggaagcctg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Synthetic

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNK5664 was a gift from Alexander Mishin (Addgene plasmid # 219747 ; http://n2t.net/addgene:219747 ; RRID:Addgene_219747)

  • For your References section:

    An improved pathway for autonomous bioluminescence imaging in eukaryotes. Shakhova ES, Karataeva TA, Markina NM, Mitiouchkina T, Palkina KA, Perfilov MM, Wood MG, Hoang TT, Hall MP, Fakhranurova LI, Alekberova AE, Malyshevskaia AK, Gorbachev DA, Bugaeva EN, Pletneva LK, Babenko VV, Boldyreva DI, Gorokhovatsky AY, Balakireva AV, Gao F, Choob VV, Encell LP, Wood KV, Yampolsky IV, Sarkisyan KS, Mishin AS. Nat Methods. 2024 Mar;21(3):406-410. doi: 10.1038/s41592-023-02152-y. Epub 2024 Jan 22. 10.1038/s41592-023-02152-y PubMed 38253843
Related items:
Commonly requested with: