pNK3203
(Plasmid
#219749)
-
PurposeDVK_AF CIDAR vector encoding hispidin-synthase from Mycena citricolor under control of CMV promoter, for mammalian expression
-
Depositing Lab
-
Depositing OrganizationLight Bio
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 219749 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 219749-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 219749-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneLevel 1-like
- Backbone size w/o insert (bp) 2231
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepCMV - mcitHispS - tSV40
-
SpeciesMycena citricolor
-
Insert Size (bp)5977
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer cctataaaaataggcgtatcacgaggcag
- 3′ sequencing primer agtcagtgagcgaggaagcctg
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySynthetic
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 219749-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 219749-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNK3203 was a gift from Alexander Mishin (Addgene plasmid # 219749 ; http://n2t.net/addgene:219749 ; RRID:Addgene_219749) -
For your References section:
An improved pathway for autonomous bioluminescence imaging in eukaryotes. Shakhova ES, Karataeva TA, Markina NM, Mitiouchkina T, Palkina KA, Perfilov MM, Wood MG, Hoang TT, Hall MP, Fakhranurova LI, Alekberova AE, Malyshevskaia AK, Gorbachev DA, Bugaeva EN, Pletneva LK, Babenko VV, Boldyreva DI, Gorokhovatsky AY, Balakireva AV, Gao F, Choob VV, Encell LP, Wood KV, Yampolsky IV, Sarkisyan KS, Mishin AS. Nat Methods. 2024 Mar;21(3):406-410. doi: 10.1038/s41592-023-02152-y. Epub 2024 Jan 22. 10.1038/s41592-023-02152-y PubMed 38253843