Skip to main content
Addgene
Open Menu

hKCNQ1 pCDNA3.1(-)
(Plasmid #219953)

Print

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 219953 Standard format: Plasmid sent in bacteria as agar stab 1 $94 *
Add to Cart
DNA 219953-D50 50 μg of DNA in Tris buffer $495 *
Add to Cart
DNA 219953-D100 100 μg of DNA in Tris buffer $585 *
Add to Cart

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pcDNA3.1(-)
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5386
  • Total vector size (bp) 7445
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    KCNQ1
  • Alt name
    Kv7.1
  • Alt name
    KvLQT1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2059
  • Mutation
    contains silent sequence variations
  • GenBank ID
    NM_000218.3
  • Entrez Gene
    KCNQ1 (a.k.a. ATFB1, ATFB3, JLNS1, KCNA8, KCNA9, KVLQT1, Kv1.9, Kv7.1, LQT, LQT1, RWS, SQT2, WRS)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    hKCNQ1 pCDNA3.1(-) was a gift from Niels Decher (Addgene plasmid # 219953 ; http://n2t.net/addgene:219953 ; RRID:Addgene_219953)

  • For your References section:

    KCNQ1 is an essential mediator of the sex-dependent perception of moderate cold temperatures. Kiper AK, Wegner S, Kadala A, Rinne S, Schutte S, Winter Z, Bertoune MAR, Touska F, Matschke V, Wrobel E, Streit AK, Lang F, Schmidt C, Schulze-Bahr E, Schafer MK, Voelkl J, Seebohm G, Zimmermann K, Decher N. Proc Natl Acad Sci U S A. 2024 Jun 18;121(25):e2322475121. doi: 10.1073/pnas.2322475121. Epub 2024 Jun 10. 10.1073/pnas.2322475121 PubMed 38857404
Related items:
Commonly requested with: