V5-BS2-SENP2 (Nuclear Pore)
(Plasmid
#220345)
-
PurposeMammalian expression vector BS2 in nuclear pore
-
Depositing Lab
-
Depositing OrganizationUniversity of Chicago
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 220345 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 * | |
| DNA | 220345-D50 | 50 μg of DNA in Tris buffer | $495 * | ||
| DNA | 220345-D100 | 100 μg of DNA in Tris buffer | $585 * | ||
* Log in to view industry pricing.
Backbone
-
Vector backboned0
- Total vector size (bp) 7058
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBS2
-
SpeciesBacillus subtilis
-
Insert Size (bp)3324
- Promoter CMV
-
Tags
/ Fusion Proteins
- V5 tag (N terminal on insert)
- SENP2 (nuclear pore localized protein) (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 220345-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 220345-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
V5-BS2-SENP2 (Nuclear Pore) was a gift from Bryan Dickinson (Addgene plasmid # 220345 ; http://n2t.net/addgene:220345 ; RRID:Addgene_220345) -
For your References section:
Bioorthogonal masked acylating agents for proximity-dependent RNA labelling. Pani S, Qiu T, Kentala K, Azizi SA, Dickinson BC. Nat Chem. 2024 Apr 9. doi: 10.1038/s41557-024-01493-1. 10.1038/s41557-024-01493-1 PubMed 38594368