Perturb-FISH
(Plasmid
#220626)
-
Purposeexpression of gRNAs under U6T7 promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 220626 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonelentiGuide-puro
-
Backbone manufacturerFeng Zhang Lab
- Backbone size w/o insert (bp) 8326
- Total vector size (bp) 10207
-
Modifications to backbonegRNA is placed under a U6T7 promoter, and uses an optimized scaffold sequence
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA
-
gRNA/shRNA sequencefiller needs to be replaced with appropriate guide library
-
SpeciesSynthetic
- Promoter BsmBI
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gagggcctatttcccatgatt
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAfter design, the plasmid was assembled by Genscript
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.11.30.569494 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Perturb-FISH was a gift from Samouil Farhi (Addgene plasmid # 220626 ; http://n2t.net/addgene:220626 ; RRID:Addgene_220626) -
For your References section:
Simultaneous CRISPR screening and spatial transcriptomics reveal intracellular, intercellular, and functional transcriptional circuits. Binan L, Jiang A, Danquah SA, Valakh V, Simonton B, Bezney J, Manguso RT, Yates KB, Nehme R, Cleary B, Farhi SL. Cell. 2025 Mar 10:S0092-8674(25)00197-7. doi: 10.1016/j.cell.2025.02.012. 10.1016/j.cell.2025.02.012 PubMed 40081369