CUP1-∆ssCPY*-mNeonGreen
(Plasmid
#221156)
-
PurposeFluorescent reporter for cytoplasmic aggregates
-
Depositing Lab
-
Depositing OrganizationUniversity of York
Located in United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 221156 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepRS316
- Backbone size w/o insert (bp) 4806
- Total vector size (bp) 7773
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCarboxypeptidase Y
-
Alt name∆ssCPY*
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)1536
-
MutationDeletion signal peptide, G255A mutation
-
Entrez GenePRC1 (a.k.a. YMR297W, CPY1, LBC1)
-
Tag
/ Fusion Protein
- mNeonGreen
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tgtatcaattgcattataatatcttcttgt
- 3′ sequencing primer aactaattacatgatatcgacaaaggaaaa
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CUP1-∆ssCPY*-mNeonGreen was a gift from Mark Leake (Addgene plasmid # 221156 ; http://n2t.net/addgene:221156 ; RRID:Addgene_221156)