Skip to main content

pTE5400_pMBP_CDS dropout vector
(Plasmid #221189)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 221189 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pSB1C3
  • Backbone size (bp) 4940
  • Modifications to backbone
    removed BsmBI site in cat gene, added pET16b expression cassette (lacI + T7 promoter-lacO) + E. coli maltose binding protein, added sfGFP dropout sequence for the CDS according to the Marburg collection
  • Vector type
    Bacterial Expression
  • Promoter T7 promoter
  • Tag / Fusion Protein
    • 10x His-tag + E. coli maltose binding protein (MBP) (N terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Cloning Information

  • Cloning method Golden Gate
  • 5′ sequencing primer GGTCGTCAGACTGTCGATG
  • 3′ sequencing primer GAAGCCTGCATAACGCGAAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For details on placeholder/dropout sequences see Stukenberg et al.: https://doi.org/10.1021/acssynbio.1c00126.

Please visit https://doi.org/10.1101/2024.04.26.591264 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTE5400_pMBP_CDS dropout vector was a gift from Tobias Erb (Addgene plasmid # 221189 ; http://n2t.net/addgene:221189 ; RRID:Addgene_221189)
  • For your References section:

    In vitro transcription-based biosensing of glycolate for prototyping of a complex enzyme cascade. Barthel S, Brenker L, Diehl C, Bohra N, Giaveri S, Paczia N, Erb TJ. Synth Biol (Oxf). 2024 Sep 20;9(1):ysae013. doi: 10.1093/synbio/ysae013. eCollection 2024. 10.1093/synbio/ysae013 PubMed 39399720