pEYFP_C1_FANCM
(Plasmid
#221384)
-
PurposeExpresses FANCM in mammalian cells
-
Depositing Lab
-
Depositing OrganizationUniversitaet Stuttgart
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 221384 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 221384-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 221384-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEYFP-C1
- Backbone size w/o insert (bp) 4734
- Total vector size (bp) 5367
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFanconi anemia group M protein
-
Alt nameFANCM
-
SpeciesH. sapiens (human)
-
Insert Size (bp)633
-
Entrez GeneFANCM (a.k.a. FAAP250, KIAA1596, POF15, SPGF28)
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CACATGGTCCTGCTGGAGTTCGT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 221384-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 221384-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEYFP_C1_FANCM was a gift from Albert Jeltsch (Addgene plasmid # 221384 ; http://n2t.net/addgene:221384 ; RRID:Addgene_221384) -
For your References section:
Discovery of NSD2 non-histone substrates and design of a super-substrate. Weirich S, Kusevic D, Schnee P, Reiter J, Pleiss J, Jeltsch A. Commun Biol. 2024 Jun 8;7(1):707. doi: 10.1038/s42003-024-06395-z. 10.1038/s42003-024-06395-z PubMed 38851815