Skip to main content

pSR1154
(Plasmid #221653)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 221653 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pSR1002
  • Backbone size w/o insert (bp) 4475
  • Total vector size (bp) 6198
  • Modifications to backbone
    Added TetR and sfGFP cassettes to detect output from tetracycline sensor
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Erythromycin, 200 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    sfGFP cassette
  • Species
    Synthetic
  • Insert Size (bp)
    989
  • Promoter PXyl-TetO

Cloning Information for Gene/Insert 1

  • Cloning method Golden Gate
  • 5′ sequencing primer aggcgattaaataagcaacatgaaca
  • 3′ sequencing primer gcgtagaaaagggaaataggcg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    TetR cassette
  • Species
    Synthetic
  • Insert Size (bp)
    759
  • Promoter PZwf

Cloning Information for Gene/Insert 2

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Low copy number replicon and erythromicin resistance in S. aureus

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSR1154 was a gift from Lauren Andrews (Addgene plasmid # 221653 ; http://n2t.net/addgene:221653 ; RRID:Addgene_221653)
  • For your References section:

    Toolbox of Characterized Genetic Parts for Staphylococcus aureus. Rondthaler SN, Sarker B, Howitz N, Shah I, Andrews LB. ACS Synth Biol. 2023 Dec 8. doi: 10.1021/acssynbio.3c00325. 10.1021/acssynbio.3c00325 PubMed 38064657