Skip to main content

pEGFP-C1_N-NLS_D652A POLH
(Plasmid #221871)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 221871 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pEGFP-C1_N-NLS
  • Total vector size (bp) 6861
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    POLH
  • Alt name
    DNA polymerase eta
  • Species
    H. sapiens (human)
  • Mutation
    D652A
  • Entrez Gene
    POLH (a.k.a. RAD30, RAD30A, XP-V, XPV)
  • Promoter CMV
  • Tag / Fusion Protein
    • NLS-EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is a variant of pEGFP-C1_N-NLS_WT POLH (Addgene #221868) with the POLH CDS mutated at D652A. This mutation prevents the ubiquitin-binding zinc finger from interacting with ubiquitin and NEDD8.

Please visit https://doi.org/10.1101/2024.10.12.618026 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-C1_N-NLS_D652A POLH was a gift from Roger Woodgate (Addgene plasmid # 221871 ; http://n2t.net/addgene:221871 ; RRID:Addgene_221871)
  • For your References section:

    Human DNA polymerase eta is regulated by mutually exclusive mono-ubiquitination and mono-NEDDylation. Moreno NC, Korchak EJ, Latancia MT, D'Orlando DA, Adegbenro T, Barnes RP, Bezsonova I, Woodgate R, Ashton NW. Nucleic Acids Res. 2026 Feb 5;54(4):gkag098. doi: 10.1093/nar/gkag098. 10.1093/nar/gkag098 PubMed 41693564