pKOSpy-sagB
(Plasmid
#222345)
-
Purposesuicide vector to generate KO in Streptococcus pyogenes
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 222345 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepUC19
- Total vector size (bp) 6313
-
Modifications to backboneSpectinomycin resistance (aad9) pheS* gene for counter selection
-
Vector typeBacterial Expression
-
Selectable markerspheS*
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin and Spectinomycin, 50 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesagB and flanking region
-
SpeciesStreptococcus pyogenes
-
Insert Size (bp)2800
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer ACCCCAGGCTTTACACTTTAT
- 3′ sequencing primer GGATGCCGGGAGCAGACAAGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKOSpy-sagB was a gift from Anne Botteaux (Addgene plasmid # 222345 ; http://n2t.net/addgene:222345 ; RRID:Addgene_222345) -
For your References section:
Efficient and rapid one-step method to generate gene deletions in Streptococcus pyogenes. Schiavolin L, Lakhloufi D, Botquin G, Deneubourg G, Bruyns C, Steinmetz J, Henrot C, Delforge V, Smeesters PR, Botteaux A. Microbiol Spectr. 2024 Oct 3;12(10):e0118524. doi: 10.1128/spectrum.01185-24. Epub 2024 Aug 20. 10.1128/spectrum.01185-24 PubMed 39162539