Skip to main content

pKOSpy-sagB
(Plasmid #222345)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 222345 Standard format: Plasmid sent in bacteria as agar stab 1 $94 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pUC19
  • Total vector size (bp) 6313
  • Modifications to backbone
    Spectinomycin resistance (aad9) pheS* gene for counter selection
  • Vector type
    Bacterial Expression
  • Selectable markers
    pheS*

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin and Spectinomycin, 50 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sagB and flanking region
  • Species
    Streptococcus pyogenes
  • Insert Size (bp)
    2800

Cloning Information

  • Cloning method Golden Gate
  • 5′ sequencing primer ACCCCAGGCTTTACACTTTAT
  • 3′ sequencing primer GGATGCCGGGAGCAGACAAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKOSpy-sagB was a gift from Anne Botteaux (Addgene plasmid # 222345 ; http://n2t.net/addgene:222345 ; RRID:Addgene_222345)
  • For your References section:

    Efficient and rapid one-step method to generate gene deletions in Streptococcus pyogenes. Schiavolin L, Lakhloufi D, Botquin G, Deneubourg G, Bruyns C, Steinmetz J, Henrot C, Delforge V, Smeesters PR, Botteaux A. Microbiol Spectr. 2024 Oct 3;12(10):e0118524. doi: 10.1128/spectrum.01185-24. Epub 2024 Aug 20. 10.1128/spectrum.01185-24 PubMed 39162539