pSR2009
(Plasmid
#222399)
-
PurposesfGFP output plasmid
-
Depositing Lab
-
Depositing OrganizationUniversity of Massachusetts, Amherst
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 222399 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonePPhlF-YFP
- Backbone size w/o insert (bp) 4311
- Total vector size (bp) 4306
-
Modifications to backboneReplaced eYFP coding sequence with sfGFP coding sequence
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namesfGFP
-
SpeciesSynthetic
-
Insert Size (bp)763
- Promoter PPhlF
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer aaaaccgaaaagattacttcg
- 3′ sequencing primer ctctgattttccagtctga
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSR2009 was a gift from Lauren Andrews (Addgene plasmid # 222399 ; http://n2t.net/addgene:222399 ; RRID:Addgene_222399)