pSR3030
(Plasmid
#222627)
-
PurposeSp-dCas9 CRISPRi plasmid targeting ompR (b3405) in E. coli MG1655
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 222627 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepSR2001
- Backbone size w/o insert (bp) 8971
- Total vector size (bp) 8616
-
Modifications to backboneReplaced LacZa cassette with gRNA spacer sequence targeting ompR
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namegRNA spacer sequence targeting ompR
-
gRNA/shRNA sequenceacgcagcaccgcacggatac
-
SpeciesSynthetic
- Promoter PTac
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer cgacgtgtataccttct
- 3′ sequencing primer cggtctgataagagaca
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSR3030 was a gift from Lauren Andrews (Addgene plasmid # 222627 ; http://n2t.net/addgene:222627 ; RRID:Addgene_222627)