Skip to main content

pCDNA3-Regnase-1 WT
(Plasmid #222653)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 222653 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 222653-D50 50 μg of DNA in Tris buffer $495
DNA 222653-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCDNA3
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5432
  • Total vector size (bp) 7223
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Zc3h12a
  • Alt name
    Mcpip1, Reg-1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1791
  • Entrez Gene
    Zc3h12a (a.k.a. MCPIP, MCPIP-1, Mcpip1, Reg1)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Vigo Heissmeyer's lab (Behrens G, Edelmann SL, Raj T, Kronbeck N, Monecke T, Davydova E, Wong EH, Kifinger L, Giesert F, Kirmaier ME, et al. (2021) Disrupting Roquin-1 interaction with Regnase-1 induces autoimmunity and enhances antitumor responses. Nat Immunol 22: 1563–1576. doi:10.1038/s41590-021-01064-3)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDNA3-Regnase-1 WT was a gift from Silvia Monticelli (Addgene plasmid # 222653 ; http://n2t.net/addgene:222653 ; RRID:Addgene_222653)
  • For your References section:

    Crosstalk between Regnase-1 and -3 shapes mast cell survival and cytokine expression. Bataclan M, Leoni C, Moro SG, Pecoraro M, Wong EH, Heissmeyer V, Monticelli S. Life Sci Alliance. 2024 Jun 3;7(8):e202402784. doi: 10.26508/lsa.202402784. Print 2024 Aug. 10.26508/lsa.202402784 PubMed 38830770