pCDNA3-Regnase-1 D141N
(Plasmid
#222654)
-
PurposeMammalian expression vector to express mouse Regnase-1 D141N mutant
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 222654 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCDNA3
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5432
- Total vector size (bp) 7223
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameZc3h12a
-
Alt nameMcpip1, Reg-1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1791
-
Mutationmutated aspartic acid 141 to asparagine to abrogate RNase activity
-
Entrez GeneZc3h12a (a.k.a. MCPIP, MCPIP-1, Mcpip1, Reg1)
- Promoter CMV
Cloning Information
- Cloning method Other
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDNA3-Regnase-1 D141N was a gift from Silvia Monticelli (Addgene plasmid # 222654 ; http://n2t.net/addgene:222654 ; RRID:Addgene_222654) -
For your References section:
Crosstalk between Regnase-1 and -3 shapes mast cell survival and cytokine expression. Bataclan M, Leoni C, Moro SG, Pecoraro M, Wong EH, Heissmeyer V, Monticelli S. Life Sci Alliance. 2024 Jun 3;7(8):e202402784. doi: 10.26508/lsa.202402784. Print 2024 Aug. 10.26508/lsa.202402784 PubMed 38830770