pSems leader-ALFA-mXFP-TpoR
(Plasmid
#222945)
-
PurposeExpression of TPOR with ALFAtag and monomeric XFP in mammalian cells
-
Depositing Lab
-
Depositing OrganizationUniversitaet Osnabrueck
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 222945 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 222945-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 222945-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepSEMS(26m)
-
Backbone manufacturerEMD Biosciences
- Total vector size (bp) 7898
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameThrombopoietin receptor (26-635)
-
Alt nameMPL, TPOR
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2708
-
MutationmXFP: tryptophan 66 to phenylalanine, TPOR: Signal peptide (1-25) deleted
-
Entrez GeneMPL (a.k.a. C-MPL, CD110, MPLV, THCYT2, THPOR, TPOR)
- Promoter CMV
-
Tags
/ Fusion Proteins
- mXFP (N terminal on insert)
- ALFAtag (N terminal on insert)
- Ig k-chain leader sequence (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRV (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CAACAGCTGGCCCTCGCAGA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 222945-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 222945-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSems leader-ALFA-mXFP-TpoR was a gift from Jacob Piehler (Addgene plasmid # 222945 ; http://n2t.net/addgene:222945 ; RRID:Addgene_222945) -
For your References section:
Correlative single-molecule and structured illumination microscopy of fast dynamics at the plasma membrane. Winkelmann H, Richter CP, Eising J, Piehler J, Kurre R. Nat Commun. 2024 Jul 10;15(1):5813. doi: 10.1038/s41467-024-49876-9. 10.1038/s41467-024-49876-9 PubMed 38987559